View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13267_high_2 (Length: 454)
Name: NF13267_high_2
Description: NF13267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13267_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 6 - 209
Target Start/End: Original strand, 2660972 - 2661175
Alignment:
| Q |
6 |
ataagaataatgttgatgaggatttgaaagagcaggatgatggtgaagataggcctggtttagggttaggttttgggtcggctagtgtatcggggtctgg |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660972 |
ataaggataatgttgatgaggatttgaaagagcaggatgatggtgaagataggcctggttttgggttaggttttgggtcggctagtgtatcggggtctgg |
2661071 |
T |
|
| Q |
106 |
tctaggatttaattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661072 |
tctaggatttaattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcg |
2661171 |
T |
|
| Q |
206 |
tttg |
209 |
Q |
| |
|
|||| |
|
|
| T |
2661172 |
tttg |
2661175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 284 - 421
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
| Q |
284 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661253 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata |
2661352 |
T |
|
| Q |
384 |
aagggggtggtcttgggaagaatgagcagggtatttta |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661353 |
aagggggtggtcttgggaagaatgagcagggtatttta |
2661390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 8e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 292 - 417
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
| Q |
292 |
gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt |
391 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||||||| ||||| ||| | ||||| |||||||||||| | ||||| |||||||||||||| ||| |
|
|
| T |
25951995 |
gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt |
25952091 |
T |
|
| Q |
392 |
ggtcttgggaagaatgagcagggtat |
417 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25952092 |
ggtcttgggaagaatgagcagggtat |
25952117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 297 - 417
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
| Q |
297 |
taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct |
396 |
Q |
| |
|
||||||| |||| || ||||||||||||||||| |||| | ||| || ||||| |||||||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
25945404 |
taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct |
25945500 |
T |
|
| Q |
397 |
tgggaagaatgagcagggtat |
417 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25945501 |
tgggaagaatgagcagggtat |
25945521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University