View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13269_high_5 (Length: 250)
Name: NF13269_high_5
Description: NF13269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13269_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 1911500 - 1911747
Alignment:
| Q |
7 |
gtgagatgaaggggggaaaacaatgaagtgagaatctttcttttgcttggttggtatgtctcataagtcacacaacttgcatgtgaggtctataatctaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1911500 |
gtgacatgaaggggggaaaacaatgaagtgagaatctttcttttgcttggttggtatgtctcataagtcacacaacttgcatgtgaggtctataatctaa |
1911599 |
T |
 |
| Q |
107 |
gttatataaaaaa----tatatatgtgtataagttagatatgacgcattgtattttcatatgcttattcatggtccattttgacacatatatatgcttag |
202 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1911600 |
gttatataaaaaatacttatatctgtgtataagttagatatgacgcattgtattttcatatgcttattcatggagcattttgacacatatatatgcttag |
1911699 |
T |
 |
| Q |
203 |
actttttgatttaatataatatacaagttcattagaatatgggtttaa |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
1911700 |
actttttggtttaatataatatacaagttcaataaaatatgggtttaa |
1911747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University