View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_high_21 (Length: 279)
Name: NF1326_high_21
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 83 - 269
Target Start/End: Complemental strand, 38127771 - 38127585
Alignment:
| Q |
83 |
aagtcaatagggtcacacgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccattatttcttgatcattttgatca |
182 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38127771 |
aagtcaataaggtcacatgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccgttatttcttgatcattttgatca |
38127672 |
T |
 |
| Q |
183 |
cagatgaaattaattcattttactttctctnnnnnnnnnnnngtaatactctaacaaaacataaataaacaatcacattcattcatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38127671 |
cagatgaaattaattcattttactttctctaaaaaagaaaaagtaatactctaacaaaacataaataaacaatcatattcattcatc |
38127585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 38128082 - 38127995
Alignment:
| Q |
1 |
aacctcaacataccacagaacacagatggttgaaaccccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca |
88 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38128082 |
aacctcaacataccgcagaacacagatggttgaaaacccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca |
38127995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 43970089 - 43970142
Alignment:
| Q |
107 |
ttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccat |
160 |
Q |
| |
|
|||||||||| ||||||||| || |||| |||||| ||||||||||||||||| |
|
|
| T |
43970089 |
ttgctagagcgtccttatccaatcctagcccccatattttctatgatgtaccat |
43970142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University