View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_13 (Length: 437)
Name: NF1326_low_13
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 197 - 312
Target Start/End: Complemental strand, 39322446 - 39322331
Alignment:
| Q |
197 |
tttgtacactgaccataatatgtgactgattttattttttcgaacaggaatttgcatattaatataatacgctactttgaaattcttgaaggggaaattg |
296 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39322446 |
tttgtacactgaccataatatgtgaatgattttattttttcgaacaggaatttgcatattaatataatacgctactttgaaattcttgaaggggaaattg |
39322347 |
T |
|
| Q |
297 |
tttatcaactattatt |
312 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39322346 |
tttatcaactattatt |
39322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 39322492 - 39322444
Alignment:
| Q |
126 |
acctgtgtgccatcctggaactttacttttgcatatttgtaaattattt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39322492 |
acctgtgtgccatcctggaactttacttttgcttatttgtaaattattt |
39322444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University