View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_21 (Length: 327)
Name: NF1326_low_21
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 15 - 130
Target Start/End: Complemental strand, 42755877 - 42755762
Alignment:
| Q |
15 |
tattgcttgtaagtgaaggcaaaatcccagactgacacatgatctagactcagaatattcctcattttattatttaataataaattaattcacaatacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42755877 |
tattgcttgtaagtgaaggcaaaattccagactgacacatgatctggactcagaatattcctcattttattatttaataataaattaattcacaatacaa |
42755778 |
T |
 |
| Q |
115 |
taggtccacaatgaca |
130 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42755777 |
taggtccacaatgaca |
42755762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 42755692 - 42755631
Alignment:
| Q |
169 |
cctctgatggaggactatgtgaaggatcagacaaatgaggaggcaaagaaccagaacgaata |
230 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42755692 |
cctctgatggagggctatgtgaaggatcagacaaatgaggaggcaaagaaccagaacgaata |
42755631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University