View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_29 (Length: 270)
Name: NF1326_low_29
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 247
Target Start/End: Original strand, 28535053 - 28535271
Alignment:
| Q |
29 |
aagaatatataatgcctgtttatgaaaattatggagcatttgatcaaattgtgtcacttgattgtgatgcttcagcttcttggattccaaatttggttga |
128 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28535053 |
aagaaaatataatgcctgtttatgaaaattatggagcatttgatcaaattgtgtcacttgattgtgatgcttcagcttcttggattccaaatttggttga |
28535152 |
T |
|
| Q |
129 |
tcaacaagatttcgctgttccggctttattatcagattgtaaaatgggattttatggtggagggtttcagaatttcaatggtagatataataataatcag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28535153 |
tcaacaagatttcgctgttccggctttattatcagattgtaaaatgggattttatggtggagggtttcagaatttcaatggtagatataataataatcag |
28535252 |
T |
|
| Q |
229 |
ccacatattattggacatg |
247 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
28535253 |
ccacatattattggtcatg |
28535271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University