View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_33 (Length: 252)
Name: NF1326_low_33
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 2494888 - 2495018
Alignment:
| Q |
1 |
agaacaccatttgaaaaaggtgagatttttggggttgttgaggttgtgaattttgttgtgggtgtttcagtttca---tgttgttctggtgatttagtta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2494888 |
agaacaccatttgaaaaaggtgagatttttggggttgttgaggttgtgaattttgttgtgggtgtttcagtttcatgttgttgttctggtgatttagtta |
2494987 |
T |
|
| Q |
98 |
aggttgttgtagatgctgttaatattgttgg |
128 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
2494988 |
aggttgttgtagatgctgttaatatggttgg |
2495018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University