View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_39 (Length: 224)
Name: NF1326_low_39
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 166
Target Start/End: Original strand, 45264560 - 45264712
Alignment:
| Q |
14 |
tcataggtggagatgaatgtgtcatattcctacgtagttgtaggaatatgtcagctacatttgtggaaagtatattgttctttaaacttccaaaatagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||| ||| |||||||||| |
|
|
| T |
45264560 |
tcataggtggagatgaatgtgtcatattcctacgtagttgtaggaatatgtcagctgcatttgtgcaaagcatattgttctttaagctttcaaaatagct |
45264659 |
T |
 |
| Q |
114 |
ttcagacatccgaaattgatcattttatcttcaactgtaattaactatcgttc |
166 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45264660 |
ttcagacacccgaaattgatcattttatcttcaacggtagttaactatcgttc |
45264712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University