View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1326_low_40 (Length: 210)

Name: NF1326_low_40
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1326_low_40
NF1326_low_40
[»] chr7 (1 HSPs)
chr7 (1-34)||(2494879-2494912)


Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 2494912 - 2494879
Alignment:
1 tctcacctttttcaaatggtgttctcaaacgttt 34  Q
    ||||||||||||||||||||||||||||||||||    
2494912 tctcacctttttcaaatggtgttctcaaacgttt 2494879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University