View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_45 (Length: 201)
Name: NF1326_low_45
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 45264679 - 45264561
Alignment:
| Q |
1 |
atcaatttcggatgtctgaaagctattttggaagtttaaagaacaatatactttccacaaatgtagctgacatattcctacaactacgtaggaatatgac |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| |||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264679 |
atcaatttcgggtgtctgaaagctattttgaaagcttaaagaacaatatgctttgcacaaatgcagctgacatattcctacaactacgtaggaatatgac |
45264580 |
T |
 |
| Q |
101 |
acattcatctccacctatg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45264579 |
acattcatctccacctatg |
45264561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University