View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326_low_46 (Length: 201)
Name: NF1326_low_46
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 45264655 - 45264754
Alignment:
| Q |
1 |
tagctttcagacatccgaaattgatcattttatcttcaacggtagttaactatcgttcgctcagtaagatacaatacaatggtgtcacaaaatgatatat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264655 |
tagctttcagacacccgaaattgatcattttatcttcaacggtagttaactatcgttcgcttagtaagatacaatacaatggtgtcacaaaatgatatat |
45264754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 46896211 - 46896252
Alignment:
| Q |
18 |
aaattgatcattttatcttcaacggtagttaactatcgttcg |
59 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
46896211 |
aaattgatcattctatctccaacgatagttaactatcgttcg |
46896252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University