View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13270_high_20 (Length: 212)
Name: NF13270_high_20
Description: NF13270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13270_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 11047331 - 11047508
Alignment:
| Q |
17 |
aatattgtcggtactaccgtacaatgcatgcacgaacttttcatagaaagaagaagaagagaacaggctgtatatggggaaatgnnnnnnnnnnnntcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11047331 |
aatattgtcggtactaccgtacaatgcatgcacgaacttttcatagaaagaagaagaagagaacaggctgtatatggggaaatggagagagagaaatcta |
11047430 |
T |
 |
| Q |
117 |
cagagttttatcactatagtaagatctaaagcttagagaccacatctttgtaattggacctactgagattttcccctc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11047431 |
cagagttttatcactatagtaagatctaaagcttagagaccacatctttgtaattggacctactgagattttcccctc |
11047508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University