View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13271_high_19 (Length: 230)
Name: NF13271_high_19
Description: NF13271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13271_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 51823679 - 51823866
Alignment:
| Q |
23 |
taaattatactggaagaaagtcaggtgctatagttgtcaaagttttggtcattttgcatatgagtgaagaagcagcaaatcactaagagcaaatgctgat |
122 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823679 |
taaattttactggaagaaagtcaggtgctaa--ttgtcaaagttttggtcattttgcatatgagtgaagaagcagcaaatcactaagagcaaatgctgat |
51823776 |
T |
|
| Q |
123 |
tatgaagcactagttgttgaagaccactcaactgattaagatcatgtaaagattaaagttatgacttgaatgaaacttatgcaaaaaact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823777 |
tatgaagcactagttgttgaagaccactcaactgattaagatcatgtaaagattaaagttatgacttgaatgaaacttatgcaaaaaact |
51823866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 93
Target Start/End: Original strand, 51834434 - 51834466
Alignment:
| Q |
61 |
aaagttttggtcattttgcatatgagtgaagaa |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51834434 |
aaagttttggtcattttgcatatgagtgaagaa |
51834466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University