View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13271_high_7 (Length: 439)
Name: NF13271_high_7
Description: NF13271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13271_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 4 - 172
Target Start/End: Original strand, 39772710 - 39772878
Alignment:
| Q |
4 |
atcaaagggttggagagggtaacctaaagcttgtttcacttctaacaagtgggtttccatccacgcgctgtctgtggttttgagtggcgcgtgggggaga |
103 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772710 |
atcaaagggttggagagggtaacctaacgcttgtttcacttctaacaagtgggtttccatccacgcgctgtctgtggttttgagtggcgcgtgggggagg |
39772809 |
T |
|
| Q |
104 |
catgagcttaaaagggggaatgtggatagggttagttgaggactgttgatgaggtttttgtttcggagg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772810 |
catgagcttaaaagggggaatgtggatagggttagttgaggactgttgatgaggtttttgtttcggagg |
39772878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 238 - 345
Target Start/End: Original strand, 39772944 - 39773051
Alignment:
| Q |
238 |
ctgttcgagttctttgagaagtcgttgaggactgtttggaggaagtgggtttgtggttagtgcataaatgtggagggttttgtggggtgttatggttttg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39772944 |
ctgttcgagttctttgagaagtcgttgaggactgttgggaggaagtgggtttgtggttagtgcataaatgtggagggttttttggggtgttatggttttg |
39773043 |
T |
|
| Q |
338 |
ttggtggg |
345 |
Q |
| |
|
|||||||| |
|
|
| T |
39773044 |
ttggtggg |
39773051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University