View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13271_low_19 (Length: 238)
Name: NF13271_low_19
Description: NF13271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13271_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 7202043 - 7201839
Alignment:
| Q |
17 |
atttgataagttgatgcgggactttgaatctgcaatatcccttttcttcaggttagtgtattcgaattttacctttatactctttgatacacaaaaaagt |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7202043 |
atttgataagttgatgcgggagtttgaatctgcaatatcccttttcttcatgtcagtgtatttgaattttacctttatactctttgatacacaaaaaagt |
7201944 |
T |
 |
| Q |
117 |
tcactccaatatatatgcattttagtggattaagtggaaaatgtcaccaagtgtg----gatagtgttgtgttgtcagagttaaactcacccattgttta |
212 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| | || |
|
|
| T |
7201943 |
tcactcga--atatatgcattttagtggattaagtggaaaatgtcaccaagtgtggatagatagtgttgtgttgtgagagttaaactcacccattctata |
7201846 |
T |
 |
| Q |
213 |
gaagagt |
219 |
Q |
| |
|
||||||| |
|
|
| T |
7201845 |
gaagagt |
7201839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University