View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13271_low_20 (Length: 230)

Name: NF13271_low_20
Description: NF13271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13271_low_20
NF13271_low_20
[»] chr4 (2 HSPs)
chr4 (23-212)||(51823679-51823866)
chr4 (61-93)||(51834434-51834466)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 51823679 - 51823866
Alignment:
23 taaattatactggaagaaagtcaggtgctatagttgtcaaagttttggtcattttgcatatgagtgaagaagcagcaaatcactaagagcaaatgctgat 122  Q
    |||||| |||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51823679 taaattttactggaagaaagtcaggtgctaa--ttgtcaaagttttggtcattttgcatatgagtgaagaagcagcaaatcactaagagcaaatgctgat 51823776  T
123 tatgaagcactagttgttgaagaccactcaactgattaagatcatgtaaagattaaagttatgacttgaatgaaacttatgcaaaaaact 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51823777 tatgaagcactagttgttgaagaccactcaactgattaagatcatgtaaagattaaagttatgacttgaatgaaacttatgcaaaaaact 51823866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 93
Target Start/End: Original strand, 51834434 - 51834466
Alignment:
61 aaagttttggtcattttgcatatgagtgaagaa 93  Q
    |||||||||||||||||||||||||||||||||    
51834434 aaagttttggtcattttgcatatgagtgaagaa 51834466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University