View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13271_low_6 (Length: 488)
Name: NF13271_low_6
Description: NF13271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13271_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 9e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 262 - 488
Target Start/End: Complemental strand, 4776490 - 4776280
Alignment:
| Q |
262 |
ttgatgatttattactatgcggcaacgattctagttttctagatcaatttaaacaggcacttgcagatcaattttccctcaaagacttgggccagccaag |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4776490 |
ttgatgatttattactatgcggcaacgattctagttttccagatcaatttaaagaggcacttgcagatcaattttccctcaaag---------------- |
4776407 |
T |
|
| Q |
362 |
ccactttcttggagttgaaattataccaaccaagaccggcttatttcttacacaacatcattacatcaaagatattctccttcgtgcaaacatgggtgat |
461 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| |||||||||||||||||| ||||| |||| | ||||||||||||||| ||||||||||| || |
|
|
| T |
4776406 |
ccactttcttggagtcgaaattataccaaccaggactggcttatttcttacacaagatcatcacataagagatattctccttcgagcaaacatgggcgac |
4776307 |
T |
|
| Q |
462 |
tgcaaacctgtgtctactcccatggcc |
488 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4776306 |
tgcaaacctgtgtctactcccatggcc |
4776280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 126 - 182
Target Start/End: Complemental strand, 446982 - 446926
Alignment:
| Q |
126 |
ctttagccctgtcatcaaacctcaaacaatgaagattgttctcggcattgctctctc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
446982 |
ctttagccctgtcatcaaacctcaaacaatcaagattgttctctgcattgctctctc |
446926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University