View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13272_high_3 (Length: 464)
Name: NF13272_high_3
Description: NF13272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13272_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 816644 - 816529
Alignment:
| Q |
1 |
caattttggttttcatttcttgctatgagtttttgttgtaaaattgtatggattgtggtttgattaatcggttctctgcctaattgtggttttcttatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
816644 |
caattttggttttcatttcttgctatgagtttttgttgtaaaattgtatggattgtggtttgattaattggttctctgcctaattgtggttttcttatga |
816545 |
T |
 |
| Q |
101 |
gcttgatttttaatta |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
816544 |
gcttgatttttaatta |
816529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 192 - 252
Target Start/End: Complemental strand, 816453 - 816393
Alignment:
| Q |
192 |
gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
816453 |
gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg |
816393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 366
Target Start/End: Complemental strand, 816316 - 816279
Alignment:
| Q |
329 |
aatagggtctttcctttgctttgttgcggcttcttatc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
816316 |
aatagggtctttcctttgctttgttgcggcttcttatc |
816279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 195 - 252
Target Start/End: Complemental strand, 816737 - 816678
Alignment:
| Q |
195 |
aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatg |
252 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
816737 |
aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatg |
816678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University