View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13272_high_6 (Length: 283)
Name: NF13272_high_6
Description: NF13272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13272_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 33 - 265
Target Start/End: Original strand, 18923659 - 18923891
Alignment:
| Q |
33 |
ccaagtccctcaatcttatctttagcttctcttctagcggctctcactctctcacatactcacaaacaccaaacacggtcgaatcagatctacatctcct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18923659 |
ccaagtccctcaatcttatctttagcttctcttctagcggctctcactctctcacatactcacaaacaccaaacacggtcgaatcagatctacatctcct |
18923758 |
T |
|
| Q |
133 |
tgaatattttaaaagttaaaagcacggttaacaattttaatgttcatggcttcctcaagttcttcttccagcaccaacttattcgttgcggaccatcctg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18923759 |
tgaatattttaaaagttaaaagcacggttaacaattttaatgttcatggcttcctcaagttcttcttccagcaccaacttattcgttgcggaccatcctg |
18923858 |
T |
|
| Q |
233 |
tgggggttgaatctcgtgtgcaagaggttattc |
265 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
18923859 |
tgggggttgaatctcgtgtacaagaggttattc |
18923891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 169 - 265
Target Start/End: Complemental strand, 34716154 - 34716058
Alignment:
| Q |
169 |
ttaatgttcatggcttcctcaagttcttcttccagcaccaacttattcgttgcggaccatcctgtgggggttgaatctcgtgtgcaagaggttattc |
265 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
34716154 |
ttaattttcatggcttcctccagttctacttccagcaccaacttatttgttgcggaccatccagtgggggtggaatctcgtgtacaagaggttattc |
34716058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 265
Target Start/End: Complemental strand, 34727985 - 34727929
Alignment:
| Q |
209 |
acttattcgttgcggaccatcctgtgggggttgaatctcgtgtgcaagaggttattc |
265 |
Q |
| |
|
||||||||||||| |||||||| |||||||| || |||||||| ||||| ||||||| |
|
|
| T |
34727985 |
acttattcgttgcagaccatccagtgggggtagattctcgtgttcaagatgttattc |
34727929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University