View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13272_low_3 (Length: 464)

Name: NF13272_low_3
Description: NF13272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13272_low_3
NF13272_low_3
[»] chr3 (4 HSPs)
chr3 (1-116)||(816529-816644)
chr3 (192-252)||(816393-816453)
chr3 (329-366)||(816279-816316)
chr3 (195-252)||(816678-816737)


Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 816644 - 816529
Alignment:
1 caattttggttttcatttcttgctatgagtttttgttgtaaaattgtatggattgtggtttgattaatcggttctctgcctaattgtggttttcttatga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
816644 caattttggttttcatttcttgctatgagtttttgttgtaaaattgtatggattgtggtttgattaattggttctctgcctaattgtggttttcttatga 816545  T
101 gcttgatttttaatta 116  Q
    ||||||||||||||||    
816544 gcttgatttttaatta 816529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 192 - 252
Target Start/End: Complemental strand, 816453 - 816393
Alignment:
192 gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
816453 gtgaaattgtatatattatggttcgattaattgggtctttgcttagttgtggtttcttatg 816393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 329 - 366
Target Start/End: Complemental strand, 816316 - 816279
Alignment:
329 aatagggtctttcctttgctttgttgcggcttcttatc 366  Q
    ||||||||||||||||||||||||||||||||||||||    
816316 aatagggtctttcctttgctttgttgcggcttcttatc 816279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 195 - 252
Target Start/End: Complemental strand, 816737 - 816678
Alignment:
195 aaattgtatat--attatggttcgattaattgggtctttgcttagttgtggtttcttatg 252  Q
    |||||||||||  ||| ||||| |||||||||||| |||||||| |||||||||||||||    
816737 aaattgtatatgaattgtggtttgattaattgggtttttgcttaattgtggtttcttatg 816678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University