View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_high_41 (Length: 228)
Name: NF13273_high_41
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_high_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 24058876 - 24058682
Alignment:
| Q |
19 |
agccgaagctaccctttacatgggttgtaacgtggctcttatcaagaagaggacccttttttgatatgccaaaatcagcaacttttggcacaaggttttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24058876 |
agccgaagctaccctttacatgggttgtaacgtggctcttatcaagaagaggacccttttttgatatgccaaaatcagcaacttttggcacaaggttttc |
24058777 |
T |
|
| Q |
119 |
atccaagagaatgtttgttgttttcacatcacggtgaattatgctttgtttagctccagtgtgaagataaagaagtcctttcgcagcccctatgc |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24058776 |
atccaagagaatgtttgttgtcttcacatcacggtgaattatgctttgtttagctccagtgtgaagataaagaagtcctttcgcagccccgatgc |
24058682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 27 - 196
Target Start/End: Complemental strand, 14685156 - 14684987
Alignment:
| Q |
27 |
ctaccctttacatgggttgtaacgtggctcttatcaagaagaggacccttttttgatatgccaaaatcagcaacttttggcacaaggttttcatccaaga |
126 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14685156 |
ctaccctttacattcgttgtaacgtgactcttatcaagaattggaccctttttcgatatgccaaaatcagcaacttttggcacaagattttcgtccaaga |
14685057 |
T |
|
| Q |
127 |
gaatgtttgttgttttcacatcacggtgaattatgctttgtttagctccagtgtgaagataaagaagtcc |
196 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
14685056 |
gaatgtttgctgtcttcacatcacggtgaattatgctttgtttagctccagtgtgaagatataaaagtcc |
14684987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 27 - 210
Target Start/End: Original strand, 14671157 - 14671340
Alignment:
| Q |
27 |
ctaccctttacatgggttgtaacgtggctcttatcaagaagaggacccttttttgatatgccaaaatcagcaacttttggcacaaggttttcatccaaga |
126 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
14671157 |
ctaccctttacattagttgtaacgtgactcttatcaagaataggaccctttttcgatatgccaaaatcagcaacttttggtacaagattttcgtccaaga |
14671256 |
T |
|
| Q |
127 |
gaatgtttgttgttttcacatcacggtgaattatgctttgtttagctccagtgtgaagataaagaagtcctttcgcagccccta |
210 |
Q |
| |
|
||||||||||||| || | ||||||||||||||||||| ||||||||||||||||||||| | |||||| || |||||||||| |
|
|
| T |
14671257 |
gaatgtttgttgtctttatgtcacggtgaattatgctttctttagctccagtgtgaagatataaaagtccctttgcagccccta |
14671340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 27 - 210
Target Start/End: Complemental strand, 30730663 - 30730480
Alignment:
| Q |
27 |
ctaccctttacatgggttgtaacgtggctcttatcaagaagaggacccttttttgatatgccaaaatcagcaacttttggcacaaggttttcatccaaga |
126 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||| |||| ||||||| |
|
|
| T |
30730663 |
ctaccctttacattagttgtaacgtgactcttatcaagaataggaccctttttcgatatgccaaaatcagaaacttttggcacaatctttttgtccaaga |
30730564 |
T |
|
| Q |
127 |
gaatgtttgttgttttcacatcacggtgaattatgctttgtttagctccagtgtgaagataaagaagtcctttcgcagccccta |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| | |||||| || |||||||||| |
|
|
| T |
30730563 |
gaatgtttgttgtcttcacgtcacggtgaattatgctttgtttagctccagtgtgaagatataaaagtccctttgcagccccta |
30730480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 166
Target Start/End: Complemental strand, 33872813 - 33872733
Alignment:
| Q |
86 |
gccaaaatcagcaacttttggcacaaggttttcatccaagagaatgtttgttgttttcacatcacggtgaattatgctttg |
166 |
Q |
| |
|
|||||| ||||||||||| | |||| ||| ||||| || ||||||||||| || || ||||| ||||||||||| ||||| |
|
|
| T |
33872813 |
gccaaagtcagcaactttagcaacaaagttatcatctaaaagaatgtttgtcgtctttacatctcggtgaattatactttg |
33872733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University