View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_high_42 (Length: 221)
Name: NF13273_high_42
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 102 - 202
Target Start/End: Complemental strand, 20175214 - 20175117
Alignment:
| Q |
102 |
gctactgaatgaagatattaatgtaaaaataatttaagttctttagttataagtttttgaaaatgagaatttaaatttaaagaagtagaagtgaagggaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
20175214 |
gctactgaatgaagatattaatgtaaaaataatttaagttctttagttctaagttttcgaaaatgagaatttaaattta---aagtacaagtgaagggaa |
20175118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 120
Target Start/End: Complemental strand, 20175258 - 20175229
Alignment:
| Q |
91 |
tttgaaccaatgctactgaatgaagatatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20175258 |
tttgaaccaatgctactgaatgaagatatt |
20175229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 30915360 - 30915316
Alignment:
| Q |
152 |
aagtttttgaaaatgagaatttaaatttaaagaagtagaagtgaa |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
30915360 |
aagtttttgaatttgagaatttaaatttaaataagaagaagtgaa |
30915316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University