View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13273_high_44 (Length: 209)

Name: NF13273_high_44
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13273_high_44
NF13273_high_44
[»] chr5 (1 HSPs)
chr5 (25-199)||(35805969-35806140)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 199
Target Start/End: Original strand, 35805969 - 35806140
Alignment:
25 aaatggattatgacggagttttggttgtggtgttgatgatgaggagcttgtgggtgannnnnnnnnnnnnnnncttcccgttttttgctcatgatgacct 124  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||                |||||  ||||||||||||||||||||    
35805969 aaatggactatgacggagttttggttgtggtgttgatgatgaggagtttgcgggtgatttttgttttttt---cttcctattttttgctcatgatgacct 35806065  T
125 catatttgggtccatcacagccgctgcttactcgcgtcggtttaaggttgtcttcgctttggctcgtggcttcat 199  Q
    ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
35806066 catatttgggttcatctcagccgctgcttactcgcgtcggtttaaggttgtcttcgttttggctcgtggcttcat 35806140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University