View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_19 (Length: 351)
Name: NF13273_low_19
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_19 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 105 - 351
Target Start/End: Original strand, 286112 - 286378
Alignment:
| Q |
105 |
atgtcttgttggtgtgggacatccaaatttgcgtgttgtacactttgcacaattttggaaactttactaatactattattgttaatttca-----ttcat |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
286112 |
atgtcttgttggtgtgggacatc-aaatttgcgtgttgtacactttgcacaattttggaaactttactaatactattattgttaatttcaattcattcat |
286210 |
T |
|
| Q |
200 |
ggttttagctaagttttgtaatttattcaat----------------cagtgagagttatttacttactatggcaccaaaagaagatgaagctcataaag |
283 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
286211 |
ggttttagctaagttttgtaatttattgaattaatataatatgatatcagtgagagttatttacttactatggcacctaaagaagatgaagctcataaag |
286310 |
T |
|
| Q |
284 |
ctgctgagattgcaattggttccattggtcgtggatatgatatatcttctgattttaggctcaagttt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
286311 |
ttgctgagattgcaattggttccattggtcgtggatatgatatatcttctgatataaggctcaagttt |
286378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University