View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_20 (Length: 347)
Name: NF13273_low_20
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 149 - 334
Target Start/End: Original strand, 10086966 - 10087151
Alignment:
| Q |
149 |
ggcagagaaaattgaaaagaagtatagtaatggaatgagtaatgcaagggaacttgaagaaagaggttgtattgttctttatgatgttgatgttaaggtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10086966 |
ggcagagaaaattgaaaagaagtatagtaatggaatgagtaatgcaagggaacttgaagaaaggggttgtattgttctttatgatgttgatgttaaagtg |
10087065 |
T |
 |
| Q |
249 |
atgagtcagcatttctttctcaagactcagaggtttgatcgtgttgtttataattttcctcatgttggcttcctttaccctgagaa |
334 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10087066 |
atgagtcagcatttctttcttaagactcagaggtttgatcttgttgtttataattttcctcatgttggattcctttaccctgagaa |
10087151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 10086835 - 10086928
Alignment:
| Q |
18 |
tttggttctgctcataaccttatagccacttcccttgattcccagggtaatgaaaatcaaaacttttaaccttttttagcatgcccatttatca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10086835 |
tttggttctgctcataaccttatagccacttcccttgattcccagggtaatgaaaatcaaaacttttaaccttttttagcatgcccatttatca |
10086928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University