View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_26 (Length: 295)
Name: NF13273_low_26
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_26 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 86 - 295
Target Start/End: Complemental strand, 28615375 - 28615174
Alignment:
| Q |
86 |
aagtgattaaataaatgcacacaaatatttttctcactaccaagagaaaacaataaagtttagtaactaaatttaatggtaaaataagtgatgcattaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
28615375 |
aagtgattaaataaatgcacacaaatatttttctcactaccaagagaaaacaataaagtttagaaactaaatttaatggtaaaataagtgatgcatt-aa |
28615277 |
T |
 |
| Q |
186 |
atcgctctcaaaatttaaggtatgtaatttttaggtcagatatatcttatcaaattcgagattctcaatcgttacatcatacatcagacttaggatatct |
285 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28615276 |
atcgctctcaaaatttagggtatgtaattttcaggtcagatatatcttatcaaattcgagattctcaatcgt-------tacatcagacttaggatatct |
28615184 |
T |
 |
| Q |
286 |
atagcataac |
295 |
Q |
| |
|
|||||||||| |
|
|
| T |
28615183 |
atagcataac |
28615174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 28615437 - 28615409
Alignment:
| Q |
18 |
actaattagctgttagaagctttgtagac |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28615437 |
actaattagctgttagaagctttgtagac |
28615409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University