View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_30 (Length: 274)
Name: NF13273_low_30
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_30 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 165 - 274
Target Start/End: Complemental strand, 2748402 - 2748293
Alignment:
| Q |
165 |
tgatgtatctatctggtgtcattccaacttctgacttgaaaagtccaactaaataggtaactacagtcccctccctatgtgcacgtaataaccagaccat |
264 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2748402 |
tgatgtatctatctggtgttattccaacttctgacttgaaaagttcaactaaataggtaactacagtcccctccctatgtgcatataataaccagaccat |
2748303 |
T |
 |
| Q |
265 |
gaaatatata |
274 |
Q |
| |
|
|||||||||| |
|
|
| T |
2748302 |
gaaatatata |
2748293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 10 - 126
Target Start/End: Complemental strand, 2748557 - 2748441
Alignment:
| Q |
10 |
aagaaaatattagacaacaacatactacactatacatcattttagttctttatattattttggttaaaccnnnnnnnagaggtatttttagtcaaacctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
2748557 |
aagaaaatattagacaacaacatactacactatacatcattttagttctttatattattttggttaaacctttttttagaggcatttttagtcaaacctg |
2748458 |
T |
 |
| Q |
110 |
aactgggaattaaattc |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2748457 |
aactgggaattaaattc |
2748441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 214 - 274
Target Start/End: Complemental strand, 2721448 - 2721388
Alignment:
| Q |
214 |
taaataggtaactacagtcccctccctatgtgcacgtaataaccagaccatgaaatatata |
274 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2721448 |
taaacaggtaactatagtcccctccctatgtgcatataataaccagaccatgaaatatata |
2721388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University