View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_36 (Length: 244)
Name: NF13273_low_36
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 33518815 - 33518949
Alignment:
| Q |
93 |
aaaaatcagtttgaaatgaactttagtagattacatcataaatgtgataatgcttacattgattttgtgcagtgtgtttgcattgctaagcctgcactta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33518815 |
aaaaatcagtttgaaatgaactttagtagattacatcataaatgtgataatgcttacattgattttgtgcagtgtgtttgcattgctaagcctgcactta |
33518914 |
T |
|
| Q |
193 |
tttatgtatggatgtaatctatatatgtggaagag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33518915 |
tttatgtatggatgtaatctatatatgtggaagag |
33518949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 33518760 - 33518818
Alignment:
| Q |
1 |
ctctcctagcaatgagtcagcttatatgcaaaatgtctatcctgttttcaggtacaaaa |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33518760 |
ctctcctagcaatgagtcagcttatatgcaaaatgtctatcctgttttcaggtacaaaa |
33518818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University