View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_43 (Length: 221)
Name: NF13273_low_43
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 11893678 - 11893717
Alignment:
| Q |
163 |
aaaatgagtgcaatgagttctgagttcgttttctctgctc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11893678 |
aaaatgagtgcaatgagttctgagttcgttttctctgctc |
11893717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 160
Target Start/End: Complemental strand, 16345608 - 16345576
Alignment:
| Q |
128 |
aagtcacgttaattctcaaagaataattttagt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16345608 |
aagtcacgttaattctcaaagaataattttagt |
16345576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 202
Target Start/End: Original strand, 20281385 - 20281418
Alignment:
| Q |
169 |
agtgcaatgagttctgagttcgttttctctgctc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20281385 |
agtgcaatgagttctgagttcgttttctctgctc |
20281418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 160
Target Start/End: Original strand, 18781564 - 18781596
Alignment:
| Q |
128 |
aagtcacgttaattctcaaagaataattttagt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18781564 |
aagtcacgttaattctcaaagaataattttagt |
18781596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University