View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13273_low_44 (Length: 209)
Name: NF13273_low_44
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13273_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 199
Target Start/End: Original strand, 35805969 - 35806140
Alignment:
| Q |
25 |
aaatggattatgacggagttttggttgtggtgttgatgatgaggagcttgtgggtgannnnnnnnnnnnnnnncttcccgttttttgctcatgatgacct |
124 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
35805969 |
aaatggactatgacggagttttggttgtggtgttgatgatgaggagtttgcgggtgatttttgttttttt---cttcctattttttgctcatgatgacct |
35806065 |
T |
|
| Q |
125 |
catatttgggtccatcacagccgctgcttactcgcgtcggtttaaggttgtcttcgctttggctcgtggcttcat |
199 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35806066 |
catatttgggttcatctcagccgctgcttactcgcgtcggtttaaggttgtcttcgttttggctcgtggcttcat |
35806140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University