View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13273_low_45 (Length: 203)

Name: NF13273_low_45
Description: NF13273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13273_low_45
NF13273_low_45
[»] chr1 (1 HSPs)
chr1 (68-186)||(760389-760507)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 68 - 186
Target Start/End: Original strand, 760389 - 760507
Alignment:
68 aaatgcaggaattaaggatcgttacctttaacgtcacacagtatgtaacagtctgaccctaccctaccaatcgacggtgtttcttgtggtcttctcgctg 167  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
760389 aaatgcaggaattatggatcgttacctttaacgtcacacagtatgtaacagtctgaccctaccctaccagtcgacggtgtttcttgtggtcttctcgctg 760488  T
168 catatctctaggataatgt 186  Q
    |||||||||||||||||||    
760489 catatctctaggataatgt 760507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University