View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13274_high_1 (Length: 403)
Name: NF13274_high_1
Description: NF13274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13274_high_1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 17 - 403
Target Start/End: Complemental strand, 19857111 - 19856725
Alignment:
| Q |
17 |
attaatgggtttgaaggttttaggagtgaggttggtttgaaaatggttgagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19857111 |
attaatgggtttgaaggttttaggagtgaggttggtttgaaaatggtggagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaag |
19857012 |
T |
|
| Q |
117 |
ttcttcattttggttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatggttttgagcttgaggagttggtgag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19857011 |
ttcttcattttggttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatggtgttgagcttgaggagttggtgag |
19856912 |
T |
|
| Q |
217 |
tgaaggttatgagctgttgggtgtttttaactggagtgatcattttcctcttctgggttggttggatttgcagggtgttaggaaaaggtgtagagctttg |
316 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19856911 |
tgaagggtatgagctgttgggtgtttttaactggagtgatcattttcctcttctgggttggttggatttgcagggtgttaagaaaaggtgtagagctttg |
19856812 |
T |
|
| Q |
317 |
gtgaaaaaggttaatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgat |
403 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856811 |
gtgacaaaggttaatacttttgttggaaagataatagaggagcataagatgaagagaatgtctgaaggaagggctatagttggtgat |
19856725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University