View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13274_high_2 (Length: 379)
Name: NF13274_high_2
Description: NF13274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13274_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 220 - 369
Target Start/End: Complemental strand, 54496923 - 54496774
Alignment:
| Q |
220 |
gtgatcttgacccacacgatattacattgtatatatgtatgtagtcacaaagcttaattcttatagaaacgaacgtctatgtagaaacttatataatctg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54496923 |
gtgatcttgacccacacgatattacattgtatatatgtatgtagtcacaaagcttaattcttatagaaacgaacgtctatgtagaaacatatataatctg |
54496824 |
T |
|
| Q |
320 |
tcatattaagaacatcatcatcaccaatgaaacccccaaccacatgatga |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54496823 |
tcatattaagaacatcatcatcaccaatgaaacccccaaccacatgatga |
54496774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 19 - 150
Target Start/End: Complemental strand, 54497116 - 54496985
Alignment:
| Q |
19 |
ggtctcatgttcgatttcctctgacgctaagggctaagtccattcagaactatgttctagctttaaattgggacctcccaagtgggcggtgggattggac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
54497116 |
ggtctcatgttcgatttcctctgacgctaagggctaagtccattcagaactgtgttctagctttaaattgggacctcccaattgggcggtggaattggac |
54497017 |
T |
|
| Q |
119 |
ctcttgaactagttggctcatgggatatatac |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54497016 |
ctcttgaactagttggctcatgggatatatac |
54496985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 119
Target Start/End: Complemental strand, 15485396 - 15485330
Alignment:
| Q |
53 |
taagtccattcagaactatgttctagctttaaattgggacctcccaagtgggcggtgggattggacc |
119 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||| ||| || | ||||||| |||||||||||||| |
|
|
| T |
15485396 |
taagtccatacaaaactatgttctggctttaaatggggtccccgcaagtggatggtgggattggacc |
15485330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 119
Target Start/End: Original strand, 37047086 - 37047150
Alignment:
| Q |
55 |
agtccattcagaactatgttctagctttaaattgggacctcccaagtgggcggtgggattggacc |
119 |
Q |
| |
|
||||||| |||| || || ||||||||||||| ||| || | ||||||| ||||||||||||||| |
|
|
| T |
37047086 |
agtccatacagagctttgctctagctttaaatggggcccccacaagtggacggtgggattggacc |
37047150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University