View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13275_high_10 (Length: 295)
Name: NF13275_high_10
Description: NF13275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13275_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 165
Target Start/End: Original strand, 41866166 - 41866319
Alignment:
| Q |
12 |
agagagataaaaagatacacaaattgatttcacattggatagaatggaaaagagtaaaattcaaacgtacaaggatggtattgcaagcagttatggtatt |
111 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41866166 |
agagagataaaaagatacacaaactgttttcacattggatagaatggaaaagagtaaaattcaaacgtacagggatggtattgcaagcagttatggtatt |
41866265 |
T |
 |
| Q |
112 |
ttgttctgcatcaacaaagaggcttcaataaagaatagagataaatcaacaatc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41866266 |
ttgttctgcatcaacaaagaggcttcaataaagaatagagataaatcaacaatc |
41866319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University