View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13275_high_16 (Length: 239)
Name: NF13275_high_16
Description: NF13275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13275_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4843378 - 4843611
Alignment:
| Q |
1 |
atgaacatcaccaaacaagccatttatacgtttatattttagaagttattttgatgggatcgtaaaggatctttttcagcttaactagaggttatgagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843378 |
atgaacatcaccaaacaagccatttatacgtttatatgttagaagttatttggatgagatcgtaaaggatctttttcagcttaactagaggttatgagtt |
4843477 |
T |
|
| Q |
101 |
ccaatccacccctaagaatggaataatgttaaatctcttnnnnnnnnnnnnnnnttttgtcatccattatgatgctaatcagttcgaggaattagtctat |
200 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
4843478 |
ccaatccaccgctaagaatgcaataatgttaaatctctt----gagagagagagttttgtcatccattatgatgctactcagttcgagagattagtctat |
4843573 |
T |
|
| Q |
201 |
gcagttgcatgcggatgatacttgattcacacataaaa |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4843574 |
gcagttgcatgcagatgatacttgattcacacataaaa |
4843611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University