View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13275_high_20 (Length: 231)
Name: NF13275_high_20
Description: NF13275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13275_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 53620638 - 53620515
Alignment:
| Q |
19 |
aacacgtcatttaaaatatatcacataattgtttttaagtacaagaattaataattatgcaaacaaagtaata-tatttttttaaatatatgaaaacaaa |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
53620638 |
aacacgtcatttaaaatatattacataattgtttttaagtacaagaattaataattatgcaaacaaagtaatattttttttttaaatatatgaaaacaaa |
53620539 |
T |
|
| Q |
118 |
gtaaatatctacttatgcttacac |
141 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53620538 |
gtaaatatctacttatgcttacac |
53620515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 218
Target Start/End: Complemental strand, 53620488 - 53620429
Alignment:
| Q |
159 |
gaggcttgtattacaaatgacattggaatccgagagattgcctttgtcatgttcacaggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620488 |
gaggcttgtattacaaatgacattggaatccgagagattgcctttgtcatgttcacaggt |
53620429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University