View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13275_high_20 (Length: 231)

Name: NF13275_high_20
Description: NF13275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13275_high_20
NF13275_high_20
[»] chr4 (2 HSPs)
chr4 (19-141)||(53620515-53620638)
chr4 (159-218)||(53620429-53620488)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 53620638 - 53620515
Alignment:
19 aacacgtcatttaaaatatatcacataattgtttttaagtacaagaattaataattatgcaaacaaagtaata-tatttttttaaatatatgaaaacaaa 117  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||    
53620638 aacacgtcatttaaaatatattacataattgtttttaagtacaagaattaataattatgcaaacaaagtaatattttttttttaaatatatgaaaacaaa 53620539  T
118 gtaaatatctacttatgcttacac 141  Q
    ||||||||||||||||||||||||    
53620538 gtaaatatctacttatgcttacac 53620515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 218
Target Start/End: Complemental strand, 53620488 - 53620429
Alignment:
159 gaggcttgtattacaaatgacattggaatccgagagattgcctttgtcatgttcacaggt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53620488 gaggcttgtattacaaatgacattggaatccgagagattgcctttgtcatgttcacaggt 53620429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University