View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13275_low_13 (Length: 279)
Name: NF13275_low_13
Description: NF13275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13275_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 44431548 - 44431300
Alignment:
| Q |
14 |
agaacctgtgggagattgctgttagcaaaatgtgttctgtgttggaggatcagttctctagaatgcaaactgctaatcatcttttgttgattaaggatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44431548 |
agaacctgtgggagattgctgttagcaaaatgtgttctgtgttggaggatcagttctctagaatgcaaactgccaatcatcttttgttgattaaggatta |
44431449 |
T |
 |
| Q |
114 |
tgtgagtctattaggagtaacactgcgtagatttggttacccgattgatgcgttgcttgatgttttaagcaagcatagggataagtatcatgaattgctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44431448 |
tgtgagtctattaggagtaacactgcgtagatttggttacccgattgatgcgttgcttgatgttttaagcaagcatagggataagtatcatgaattgctg |
44431349 |
T |
 |
| Q |
214 |
ttgtcagattgtaggaagcagatagccgaggctataggtggtgataagt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44431348 |
ttgtcagattgtaggaagcagatagccgaggctataggtggtgataagt |
44431300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University