View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13277_low_3 (Length: 440)
Name: NF13277_low_3
Description: NF13277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13277_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 4e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 9 - 119
Target Start/End: Complemental strand, 2566037 - 2565927
Alignment:
| Q |
9 |
atagaaccataaatttatgatatggttttatagtctagttccttaattcaagtagcactctatgttttgtatcagtaacttaaatcaatgctttgatagt |
108 |
Q |
| |
|
|||||| ||| ||||||||||||| ||| | ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2566037 |
atagaagcatgaatttatgatatgatttgaaagtctagtttcttaattcaagtggcactctatgttttgtatcagtaacttaaatcaatgctttgatagt |
2565938 |
T |
|
| Q |
109 |
tttgttagata |
119 |
Q |
| |
|
||||||||||| |
|
|
| T |
2565937 |
tttgttagata |
2565927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 348 - 425
Target Start/End: Complemental strand, 2565906 - 2565828
Alignment:
| Q |
348 |
ttgcttgaacacatactataaaatttcatctcatttcatttgat-ataatatagaattttcttttacaaatatgtgaat |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2565906 |
ttgcttgaacacatactataaaatttcatctcatttcatttgatgataatatagaattttcttttacaaatatgtgaat |
2565828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University