View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13279_high_18 (Length: 238)
Name: NF13279_high_18
Description: NF13279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13279_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 3422953 - 3422838
Alignment:
| Q |
13 |
atgaatctaatgatgaactgtgatagattttggagagtgaagaatctacataaattttgtactgtgttctgtgaaagtgggtaaatggtccacaggctgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3422953 |
atgaatctaatgatgaactgtgatagattttggagagtgaagaatctacataaattttgtactgtgttctgtgaaagtgggtaaatggtccacaggctgt |
3422854 |
T |
|
| Q |
113 |
cttgaatacagtacaa |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3422853 |
cttgaatacagtacaa |
3422838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 3422780 - 3422745
Alignment:
| Q |
186 |
actatatcaaattactttattttataccttcatttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3422780 |
actatatcaaattactttattttataacttcatttt |
3422745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University