View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13279_low_16 (Length: 248)
Name: NF13279_low_16
Description: NF13279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13279_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 104 - 233
Target Start/End: Complemental strand, 6809145 - 6809016
Alignment:
| Q |
104 |
gtaatcatgttattgatatgaagtatccacctactttgtcaatgacaaatctttgttggagaatatgatcacctttagtatgtttttccctctcgatcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809145 |
gtaatcatgttattgatatgaagtatccacctactttgtcaatgacaaatctttgttggagaatatgatcacctttagtatgtttttccctctcgatcac |
6809046 |
T |
 |
| Q |
204 |
cttttttcatccacatggctcgaactatat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6809045 |
cttttttcatccacatggctcgaactatat |
6809016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 6809227 - 6809157
Alignment:
| Q |
1 |
ctccctataatttagaaattttcacaaactagcaatttgtcatgttgcatgctcctttatgggaatctagc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6809227 |
ctccctataatttagaaattttcacaaactagcaatttgtcatgttgcatgctcctttatgggaatctagc |
6809157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 45
Target Start/End: Complemental strand, 6817357 - 6817318
Alignment:
| Q |
6 |
tataatttagaaattttcacaaactagcaatttgtcatgt |
45 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6817357 |
tatagtttagaaatcttcacaaactagcaatttgtcatgt |
6817318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University