View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13279_low_21 (Length: 203)
Name: NF13279_low_21
Description: NF13279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13279_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 49083311 - 49083480
Alignment:
| Q |
16 |
attctatcaaatatgaaagggagtcggctgagtataaggacgaaactggaggtatataactttcttttatcttgtatttttgttcaannnnnnngccctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49083311 |
attctatcaaatatgaaagggagtcggctgagtataaggacgtaactggaggtatataactttcttttatcttgtatttttgttcaatttttttgccctt |
49083410 |
T |
 |
| Q |
116 |
attttgttagttattgacaattaatgtttgttgcagagaaatcaactacaatagcatctaaagctgcagg |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083411 |
attttgttagttattgacaattaacgtttattgcagagaaatcaactacaatagcatctaaagctgcagg |
49083480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University