View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_high_1 (Length: 670)
Name: NF1327_high_1
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 1e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 12 - 182
Target Start/End: Complemental strand, 50658090 - 50657920
Alignment:
| Q |
12 |
agagatagagagaaaacaatgtgttaaaatatcttctcaatagatatgatattattgaggttgggtagctcaattggtctgcgttaaatgatacggagtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
50658090 |
agagatagagagaaaacaatgtgttaaaatatcttctcgatagacatgatattattggggttgggtagctcaattagtttgcgttaaatgatacggagtt |
50657991 |
T |
 |
| Q |
112 |
gaagttgttgagtttaaactcggacaaaagagaaaaactgatctaataactataagacatgatattgtttt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50657990 |
gaagttgttgagtttaaactcggacaaaagagaaaaactgatctaataactataagacatgatattgtttt |
50657920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 464 - 594
Target Start/End: Original strand, 50640157 - 50640287
Alignment:
| Q |
464 |
ataggaattccaaattactcttagaaaatattattatatctctttcacctcacaattttgcagttgttaaagggttgtgcaatgagatttgaactagtct |
563 |
Q |
| |
|
|||||||| ||||| ||||||| ||| ||| |||| ||||||||||||| |||| ||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50640157 |
ataggaatctcaaatcactcttaaaaagtatcattaaatctctttcaccttacaaattttcagttattaaagggttgtgcaatgagatttgaactagtcg |
50640256 |
T |
 |
| Q |
564 |
tacaaaagcatattggtgctgaaaatcacta |
594 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
50640257 |
tacaaaagcatattggtgctgaaaatgacta |
50640287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University