View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_high_12 (Length: 343)
Name: NF1327_high_12
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 240 - 315
Target Start/End: Original strand, 44493222 - 44493297
Alignment:
| Q |
240 |
ttataggaaagggctgctactactagattagtcagtgtagatatatagaacgaaatgatacaagtatgcttaacct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44493222 |
ttataggaaagggctgctactactagattagtcagtgtagatatatagaacgaaatgatacaagtatgcttaacct |
44493297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 44492580 - 44492673
Alignment:
| Q |
18 |
gtgagatgaacatttgtttataagtacatagtttttataaaccgattttgtatagttgaattagacacgtacactgagtagttcagggggatcc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44492580 |
gtgatatgaacatttgtttataagtagatagtttttataaatcgattttgtatagttgaattaaacacgtacattgagtagttcagggggatcc |
44492673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 44492741 - 44492811
Alignment:
| Q |
179 |
taacatgaaaaattgaatctaaatttggttactt-------gggttccccaacctctaagttgctttgtta |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44492741 |
taacatgaaaaattaaatctaaatttggttacttgggacttgggttccccaacctctaagttgctttgtta |
44492811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University