View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_high_16 (Length: 269)
Name: NF1327_high_16
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 45624523 - 45624409
Alignment:
| Q |
20 |
atatgggttatgggtaaaattgaaacaattgagagcttaatttcttcaaactttgaatttatttatacgaattttataaccgtaacataagatttgaggg |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45624523 |
atatgggttatgggtaaaactgaaacaattgagagctcaatttcttcaaactttgaatatatttatacgaattttgtaaccgtaacataagatttgaggg |
45624424 |
T |
 |
| Q |
120 |
aagaaatggagtttg |
134 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
45624423 |
aagaaatgaagtttg |
45624409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 134
Target Start/End: Original strand, 48225963 - 48226077
Alignment:
| Q |
20 |
atatgggttatgggtaaaattgaaacaattgagagcttaatttcttcaaactttgaatttatttatacgaattttataaccgtaacataagatttgaggg |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48225963 |
atatgggttatgggtaaaactgaaacaattgagagctcaatttcttcaaactttgaatatatttatacgaattttgtaaccgtaacataagatttgaggg |
48226062 |
T |
 |
| Q |
120 |
aagaaatggagtttg |
134 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
48226063 |
aagaaatgaagtttg |
48226077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University