View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_high_19 (Length: 252)
Name: NF1327_high_19
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 11696734 - 11696966
Alignment:
| Q |
1 |
tgttgaggaacattagtgaactcaatgttgttgtgaagacttcgttaattgatatgtatgtcaagtgtggatgtcttgagaaaggtttacgcgtattcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
11696734 |
tgttgaggaacattagtgaactcaatgttgttgtgaagacttcgttaattgatatgtatgtcaagagtggatgtcttgagaaaggtttacgcgtattcaa |
11696833 |
T |
 |
| Q |
101 |
gaatatgtcggagaagaatagattttcttacactgtaatgatatctggtcttgcgattcatggacgtggtaaggaagctcttaaagttttctcagaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696834 |
aaatatgtcggagaagaatagatattcttacactgtaatgatatctggtcttgcgattcatggacgtggtaaggaagctcttaaagttttctcagaaatg |
11696933 |
T |
 |
| Q |
201 |
attgaagaaggtttggcaccagatgatgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
11696934 |
attgaagaaggtttggcaccagatgatgttgtc |
11696966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University