View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_high_7 (Length: 468)
Name: NF1327_high_7
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 30 - 237
Target Start/End: Complemental strand, 47285906 - 47285699
Alignment:
| Q |
30 |
gcattcagctaaccaaataactgattcttttgctttaggacatttttgagggatttgattggatgctgcagaaacacagtctttgcattctttttgtgtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285906 |
gcattcagctaaccaaataactgattcttttgctttaggacatttttgagggatttgattggatgctgcagaaacacagtctttgcattctttttgtgtg |
47285807 |
T |
 |
| Q |
130 |
tgatctccacggcagagaaaggcaccgtacacggtgtttacagggttgttggcgccaactgtggtgtagtagaaaccatttttgtttgtggaattgggtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
47285806 |
cgatctccacggcagagaaaggcaccgtacacggtgtttacggggttgttggcgccaactgtggtgtagtagaaaccatttttgtttgtggagttggatg |
47285707 |
T |
 |
| Q |
230 |
aaagaata |
237 |
Q |
| |
|
|||||||| |
|
|
| T |
47285706 |
aaagaata |
47285699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 299 - 458
Target Start/End: Complemental strand, 47285637 - 47285478
Alignment:
| Q |
299 |
gacagtaaatctgcatgaaggataggtctgtagctgcttgagttgttgttatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaa |
398 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285637 |
gacagtaactctggatgaaggataggtctgtagctgcttgagttgttattatggttataattagtgtgaagcaaaagaaaacatagacagtggtagagaa |
47285538 |
T |
 |
| Q |
399 |
tttgaagtggtgcagcatttgtttttgatggatcatgttttttgctcttgatgtcctttg |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47285537 |
tttgaagtggtgcagcatttgtttttgatggatcatgttttttgctcttgatgttctttg |
47285478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University