View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_low_14 (Length: 319)
Name: NF1327_low_14
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 96 - 319
Target Start/End: Original strand, 24818093 - 24818332
Alignment:
| Q |
96 |
caagatggtacacttttcggaaccacaataaatgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgattgtagaaa |
195 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24818093 |
caagatggtgcacttttcggaaccacaataaatgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccactgattgtagaaa |
24818192 |
T |
 |
| Q |
196 |
acag------------------aaataaatatacttcaccaaatggttgttcaaatataattacggcataaacacacacctgctatgtgtagttactcct |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
24818193 |
acagaaataaatatacttcatcaaataaatatacttcaccaaatggttgttcaaatataattacggcataa--acacacctgctgtgtgtagttactcct |
24818290 |
T |
 |
| Q |
278 |
ttagaagcctcttcatcggtcagagagagaacagcgttgcat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24818291 |
ttagaagcctcttcatcggtcagagagagaacagcgttgcat |
24818332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 188
Target Start/End: Original strand, 40868651 - 40868712
Alignment:
| Q |
127 |
atgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgatt |
188 |
Q |
| |
|
||||||||||||||| || |||||||||| || ||||||||||||||||| || |||||| |
|
|
| T |
40868651 |
atgcagggatcccccgtagttttgctgccagagccaatgcagcagcatggtttccactgatt |
40868712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 188
Target Start/End: Complemental strand, 41875572 - 41875511
Alignment:
| Q |
127 |
atgcagggatcccccttatctttgctgccaaagataatgcagcagcatggttcccgctgatt |
188 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||| || || |||||| |
|
|
| T |
41875572 |
atgcagggattccccttagttttgctgccaaagccaatgcagcagcatgatttccactgatt |
41875511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University