View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_low_16 (Length: 314)
Name: NF1327_low_16
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 73 - 314
Target Start/End: Complemental strand, 35073395 - 35073154
Alignment:
| Q |
73 |
atgaaacagtaaccaattgggtaaggtaatatacttatcttggtgaagtttggtgtgtgtgagcttaaataaatcgtctccttcggcgctcaaactcaaa |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073395 |
atgaaacagtaaccaattcggtaaggtaatatacttatcttggtgaagtttggtgtgtgtgagcttaaataaatcgtctccttcggcgctcaaactcaaa |
35073296 |
T |
 |
| Q |
173 |
tctaaacagaagagattagaaaaaaggttannnnnnnnnnnnnnnaggtggtgtgtgaaattatgaatgtttattttcatgcttgcttcgttaacacgta |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073295 |
tctaaacagaagagattagaaaaaaggttatttttatttttttgtaggtggtgtatgaaattatgaatgtttattttcatgcttgcttcgttaacacgta |
35073196 |
T |
 |
| Q |
273 |
tcacgtgttatgatattgacacgtggagatcaaacaaggttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073195 |
tcacgtgttatgatattgacacgtggagatcaaacaaggttt |
35073154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University