View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1327_low_27 (Length: 206)
Name: NF1327_low_27
Description: NF1327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1327_low_27 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 33835411 - 33835616
Alignment:
| Q |
1 |
gtgttcaccaaacccctttagaggcataattactgttacttttggcaaattgacctgattggaatgctcaagttcattgatatcatgacatataaaagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835411 |
gtgttcaccaaacccctttagaggcataattactgttacttttggcaaattgacctgattgcaatgctcaagttcattgatatcatgacatataaaagca |
33835510 |
T |
 |
| Q |
101 |
aagctatttccattctgtatactcctccttattcttcttatctctcttttcctgtaacattaaaatgatgcaaatatgttatggacacaacaaataagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835511 |
aagctatttccattctgtatactcctccttattcttcttatctctcttttcctgtaacattaaaatgatgcaaatatgttatggacacaacaaataagag |
33835610 |
T |
 |
| Q |
201 |
tttctt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
33835611 |
tttctt |
33835616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University