View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13280_high_3 (Length: 265)
Name: NF13280_high_3
Description: NF13280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13280_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 37769304 - 37769544
Alignment:
| Q |
10 |
gcaaaggcgagacgataggctgcaatgactatgatactcattccatcataaatggcaagcttgtagatgatattgcaagcagaaaataccatctgcaccg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37769304 |
gcaaaggcgagacgataggctgcaatgactatgatattcattccatcataaatggcaagcttgtagataatattgcaagcagaaaataccatctgcaccc |
37769403 |
T |
 |
| Q |
110 |
caaccattagcaaggctggtttcaacgaattcgacatgcttcccatcttcaagatcagactgcaataagcttttgagattgaaggactatatatacacat |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769404 |
caaccattagcaaggctggtttcaatgaattcgacatgcttcccatcttcaagatcaggctgcaataagcttttgagattgaaggactatatatacacat |
37769503 |
T |
 |
| Q |
210 |
ttataggagtgaagttaggttcaaactcttcacatgatagt |
250 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37769504 |
ttatgggagggaagttaggttcaaactcttcacatgatagt |
37769544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University